Mature sequence tae-miR5384-3p

Accession numberMIMAT0035797
IDtae-miR5384-3p
Stem-Loop tae-MIR5384
Sequence
ugagcgcgccgccgucgaaug
Get sequence
Deep sequencing1314 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).