Mature sequence tae-miR9674a-5p

Accession numberMIMAT0035793
IDtae-miR9674a-5p
Sequence
gcaucauccauccuaccauuc
Get sequence
Stem-Loop tae-MIR9674a

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).