Mature sequence tae-miR1137b-5p

Accession numberMIMAT0035774
IDtae-miR1137b-5p
Stem-Loop tae-MIR1137b
Sequence
uccguuccagaauagaugacc
Get sequence
Deep sequencing122388 reads, 116 experiments

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).