Mature sequence rno-miR-3084d

Accession numberMIMAT0035745
IDrno-miR-3084d
Stem-Loop rno-mir-3084a-3
Sequence
uucugccaguccccuucagaca
Get sequence
Deep sequencing3441 reads, 348 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).