Mature sequence rno-miR-3084b-3p

Accession numberMIMAT0035742
IDrno-miR-3084b-3p
Stem-Loop rno-mir-3084a-2
Sequence
uucugccaguccccuucagaca
Get sequence
Deep sequencing3441 reads, 348 experiments

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).