Mature sequence rno-miR-1247-3p

Accession numberMIMAT0035722
IDrno-miR-1247-3p
Stem-Loop rno-mir-1247
Sequence
cgggaacgucgagacuggagc
Get sequence
Deep sequencing1155 reads, 252 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).