Mature sequence rno-let-7g-3p

Accession numberMIMAT0035720
IDrno-let-7g-3p
Stem-Loop rno-let-7g
Sequence
cuguacaggccacugccuugc
Get sequence
Deep sequencing9915 reads, 447 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).