Mature sequence rno-let-7g-5p

Accession numberMIMAT0035719
IDrno-let-7g-5p
Stem-Loop rno-let-7g
Sequence
ugagguaguaguuuguacaguu
Get sequence
Deep sequencing19800864 reads, 513 experiments
Predicted targets

References

1
PMID:23329697 "Rat mir-155 generated from the lncRNA Bic is 'hidden' in the alternate genomic assembly and reveals the existence of novel mammalian miRNAs and clusters" Uva P, Da Sacco L, Del Corno M, Baldassarre A, Sestili P, Orsini M, Palma A, Gessani S, Masotti A RNA. 19:365-379(2013).