Mature sequence bra-miR9569-3p

Accession numberMIMAT0035700
IDbra-miR9569-3p
Stem-Loop bra-MIR9569
Sequence
acacaggaacaauacuaacucauu
Get sequence
Deep sequencing reads, experiments

References

1