Mature sequence bra-miR9569-5p

Accession numberMIMAT0035699
IDbra-miR9569-5p
Stem-Loop bra-MIR9569
Sequence
ugaguuaucauuggucuugug
Get sequence
Deep sequencing reads, experiments

References

1