Mature sequence bra-miR9555b-5p

Accession numberMIMAT0035679
IDbra-miR9555b-5p
Stem-Loop bra-MIR9555b
Sequence
uguaauugcgggguucuaagc
Get sequence
Deep sequencing reads, experiments

References

1