Mature sequence bra-miR9560a-3p

Accession numberMIMAT0035674
IDbra-miR9560a-3p
Stem-Loop bra-MIR9560a
Sequence
ucauauuaguucuaccuccuguug
Get sequence
Deep sequencing reads, experiments

References

1