Mature sequence bra-miR9560a-5p

Accession numberMIMAT0035673
IDbra-miR9560a-5p
Stem-Loop bra-MIR9560a
Sequence
acaggugguggaacaaauaugagu
Get sequence
Deep sequencing reads, experiments

References

1