Mature sequence bra-miR9558-3p

Accession numberMIMAT0035670
IDbra-miR9558-3p
Stem-Loop bra-MIR9558
Sequence
uugcaagccagacauuuccuuu
Get sequence
Deep sequencing reads, experiments

References

1