Mature sequence bra-miR9558-5p

Accession numberMIMAT0035669
IDbra-miR9558-5p
Stem-Loop bra-MIR9558
Sequence
agagaugucuggcuugcaaca
Get sequence
Deep sequencing reads, experiments

References

1