Mature sequence bra-miR9408-3p

Accession numberMIMAT0035658
IDbra-miR9408-3p
Stem-Loop bra-MIR9408
Sequence
uuucaucuuagagaauguuguu
Get sequence
Deep sequencing reads, experiments

References

1