Mature sequence bra-miR9552b-3p

Accession numberMIMAT0035656
IDbra-miR9552b-3p
Stem-Loop bra-MIR9552b
Sequence
ugaccgaguagaccgauaguc
Get sequence
Deep sequencing reads, experiments

References

1