Mature sequence sly-miR171e

Accession numberMIMAT0035482
IDsly-miR171e
Stem-Loop sly-MIR171e
Sequence
uugagccgcgucaauaucucu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).