Mature sequence gsa-miR-1175-5p

Accession numberMIMAT0035254
IDgsa-miR-1175-5p
Stem-Loop gsa-mir-1175
Sequence
gucggaaaguugaauaucgaa
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24025793 "Substantial loss of conserved and gain of novel MicroRNA families in flatworms" Fromm B, Worren MM, Hahn C, Hovig E, Bachmann L Mol Biol Evol. 30:2619-2628(2013).