Mature sequence efu-miR-9258

Accession numberMIMAT0034877
IDefu-miR-9258
Stem-Loop efu-mir-9258
Sequence
ugugugcagccacucaccuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).