Mature sequence eca-miR-6529

Accession numberMIMAT0034760
IDeca-miR-6529
Stem-Loop eca-mir-6529
Sequence
ccugugccuuuuaccucuuuaa
Get sequence
Deep sequencing7 reads, 1 experiments

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).