Mature sequence eca-miR-8908b

Accession numberMIMAT0034697
IDeca-miR-8908b
Stem-Loop eca-mir-8908b-1 eca-mir-8908b-5 eca-mir-8908b-2 eca-mir-8908b-3 eca-mir-8908b-4
Sequence
uaauuaguaccugucuggguaga
Get sequence
Deep sequencing7780 reads, 1 experiments

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).