Mature sequence eca-miR-9038

Accession numberMIMAT0034580
IDeca-miR-9038
Stem-Loop eca-mir-9038
Sequence
ucacacaucagccuggugccucagu
Get sequence
Deep sequencing19 reads, 1 experiments

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).