Mature sequence eca-miR-8992

• Accession number: MIMAT0034529
• ID: eca-miR-8992
• Stem-Loop: eca-mir-8992
• Sequence: cgcgcugcaggcugcgcccgggga
• Deep sequencing: 14 reads, 1 experiments

References

1. PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).