Mature sequence cfa-miR-6529

• Accession number: MIMAT0034278
• ID: cfa-miR-6529
• Stem-Loop: cfa-mir-6529
• Sequence: ccugugccuuuuaccucuuuaa
• Deep sequencing: reads, experiments
• Predicted targets:
  • TargetScanVert:cfa-miR-6529
  • miRDB:cfa-miR-6529

References

1. PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).