Mature sequence psj-miR8788a-3p

Accession numberMIMAT0034271
IDpsj-miR8788a-3p
Stem-Loop psj-MIR8788a
Sequence
guguugguucgcuugguacgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24204767 "Phytophthora have distinct endogenous small RNA populations that include short interfering and microRNAs" Fahlgren N, Bollmann SR, Kasschau KD, Cuperus JT, Press CM, Sullivan CM, Chapman EJ, Hoyer JS, Gilbert KB, Grunwald NJ, Carrington JC PLoS One. 8:e77181(2013).