Mature sequence pin-miR8788-3p

Accession numberMIMAT0034269
IDpin-miR8788-3p
Stem-Loop pin-MIR8788
Sequence
gcgcugguucgcuugguacgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24204767 "Phytophthora have distinct endogenous small RNA populations that include short interfering and microRNAs" Fahlgren N, Bollmann SR, Kasschau KD, Cuperus JT, Press CM, Sullivan CM, Chapman EJ, Hoyer JS, Gilbert KB, Grunwald NJ, Carrington JC PLoS One. 8:e77181(2013).