Mature sequence gra-miR8778

Accession numberMIMAT0034260
IDgra-miR8778
Stem-Loop gra-MIR8778
Sequence
uuuccauauuaggguuugaacuuu
Get sequence
Deep sequencing reads, experiments

References

1