Mature sequence gra-miR8768

Accession numberMIMAT0034204
IDgra-miR8768
Stem-Loop gra-MIR8768
Sequence
uuccaugucacagagauguug
Get sequence
Deep sequencing reads, experiments

References

1