Mature sequence gra-miR8653b

Accession numberMIMAT0034201
IDgra-miR8653b
Stem-Loop gra-MIR8653b
Sequence
uucaaacuuauuuuacggcca
Get sequence
Deep sequencing reads, experiments

References

1