Mature sequence gra-miR8752

Accession numberMIMAT0034179
IDgra-miR8752
Stem-Loop gra-MIR8752
Sequence
ugauggagauagguaucugca
Get sequence
Deep sequencing reads, experiments

References

1