Mature sequence gra-miR167c

Accession numberMIMAT0034167
IDgra-miR167c
Stem-Loop gra-MIR167c
Sequence
ucagaugaagcugccagcauga
Get sequence
Deep sequencing reads, experiments

References

1