Mature sequence gra-miR8736

Accession numberMIMAT0034148
IDgra-miR8736
Stem-Loop gra-MIR8736
Sequence
guggaacguguuaagagaggaaua
Get sequence
Deep sequencing reads, experiments

References

1