Mature sequence gra-miR399

Accession numberMIMAT0034146
IDgra-miR399
Stem-Loop gra-MIR399
Sequence
gggcaccucucacuuaggcagg
Get sequence
Deep sequencing reads, experiments

References

1