Mature sequence gra-miR7492k

Accession numberMIMAT0034128
IDgra-miR7492k
Stem-Loop gra-MIR7492k
Sequence
cgugaucuuuagcggcguuug
Get sequence
Deep sequencing reads, experiments

References

1