Mature sequence gra-miR7492j

Accession numberMIMAT0034127
IDgra-miR7492j
Stem-Loop gra-MIR7492j
Sequence
cgugaucuuuagcggcguuug
Get sequence
Deep sequencing reads, experiments

References

1