Mature sequence gra-miR7492i

Accession numberMIMAT0034126
IDgra-miR7492i
Stem-Loop gra-MIR7492i
Sequence
cgugaucuuuagcggcguuug
Get sequence
Deep sequencing reads, experiments

References

1