Mature sequence gra-miR7492h

Accession numberMIMAT0034125
IDgra-miR7492h
Stem-Loop gra-MIR7492h
Sequence
cgugaucuuuagcggcguuug
Get sequence
Deep sequencing reads, experiments

References

1