Mature sequence gra-miR7492g

Accession numberMIMAT0034124
IDgra-miR7492g
Stem-Loop gra-MIR7492g
Sequence
cgugaucuuuagcggcguuug
Get sequence
Deep sequencing reads, experiments

References

1