Mature sequence gra-miR8691

Accession numberMIMAT0034064
IDgra-miR8691
Stem-Loop gra-MIR8691
Sequence
agaugaugagaaaggaaagucaag
Get sequence
Deep sequencing reads, experiments

References

1