Mature sequence esi-miR8623b

Accession numberMIMAT0033972
IDesi-miR8623b
Stem-Loop esi-MIR8623b
Sequence
cauggaacuccauggaacuccaug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).