Mature sequence atr-miR2950

Accession numberMIMAT0033951
IDatr-miR2950
Stem-Loop atr-MIR2950
Sequence
uuccaucucuugcacacugga
Get sequence
Deep sequencing2585 reads, 4 experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).