Mature sequence atr-miR535

Accession numberMIMAT0033947
IDatr-miR535
Stem-Loop atr-MIR535
Sequence
ugacaacgagagagagcacgc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).