Mature sequence pxy-miR-281

Accession numberMIMAT0033804
IDpxy-miR-281
Stem-Loop pxy-mir-281
Sequence
ugucauggaguugcucucuuua
Get sequence
Deep sequencing28 reads, 4 experiments

References

1