Mature sequence pxy-miR-8541

Accession numberMIMAT0033800
IDpxy-miR-8541
Stem-Loop pxy-mir-8541
Sequence
uaauugaggcuggcugauuggg
Get sequence
Deep sequencing15 reads, 3 experiments

References

1