Mature sequence hsa-miR-8485

Accession numberMIMAT0033692
IDhsa-miR-8485
Stem-Loop hsa-mir-8485
Sequence
cacacacacacacacacguau
Get sequence
Deep sequencing1623 reads, 135 experiments
Database links
Predicted targets
QuickGO function

References

1