Mature sequence ath-miR8177

Accession numberMIMAT0032776
IDath-miR8177
Stem-Loop ath-MIR8177
Sequence
gugugaugaugugucauuuaua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:24119003 "Integrated RNA-seq and sRNA-seq analysis identifies novel nitrate-responsive genes in Arabidopsis thaliana roots" Vidal EA, Moyano TC, Krouk G, Katari MS, Tanurdzic M, McCombie WR, Coruzzi GM, Gutierrez RA BMC Genomics. 14:701(2013).