Mature sequence ssa-miR-7552a-5p

Accession numberMIMAT0032752
IDssa-miR-7552a-5p
Stem-Loop ssa-mir-7552a-1 ssa-mir-7552a-2
Sequence
uuacaauuaaaggauauuucuu
Get sequence
Deep sequencing reads, experiments

References

1