Mature sequence ssa-miR-7552b-5p

Accession numberMIMAT0032750
IDssa-miR-7552b-5p
Stem-Loop ssa-mir-7552b
Sequence
cuacaauuaaaggauauuucuu
Get sequence
Deep sequencing reads, experiments

References

1