Mature sequence ssa-miR-8157-5p

Accession numberMIMAT0032736
IDssa-miR-8157-5p
Stem-Loop ssa-mir-8157
Sequence
uagcacauuacaguacagcugu
Get sequence
Deep sequencing reads, experiments

References

1